RNA-Secondary-Structure.md

+# RNA Secondary Structure
+
+## Introduction
+RNA structure is hierarchical.  The primary structure is the covalent bonds between nucleotides, represented as the RNA sequence.  RNA secondary structure is the set of base pairs between nucleotides that form helices.  There are many ways to represent secondary structure.  RNA tertiary structure includes all interactions between nucleotides and is represented by the 3-D coordinates of all atoms in the RNA sequence. 
+
+
+
+![SecondaryStructureMotifs](Images/RNA_secondary_structure.png)
+
+Many of the secondary structure motifs are illustrated in the figure above.  The circles are RNA nucleotides.  The solid black lines represent covalent bonds between nucleotides.  The dashed lines represent base-pair interactions between nucleotides.  The purple nucleotides represent base pairs that for form stacking interactions in an RNA helix.  The light blue nucleotides are hairpin loops, where an RNA strand folds back upon itself, leaving at least three unpaired nucleotides.  The magenta nulceotides represent bulge loops, which has unpaired nucleotides on only one strand of RNA.  The yellow nucleotides represent internal loops, which has unpaired nucleotides on both strands of RNA.  The green nucleotides represent multibranch loops, which have at least three exiting helices.  The grey nucleotides represent terminal mismatches, which have unpaired nucleotides stacking on both sides of the end of an RNA helix.  The dark blue nucleotide represent dangling ends, which have unpaired nucleotides stacking on one side of the end of an RNA helix.  
+
+## Representations of RNA Secondary Structure
+
+### Images
+
+![CirclePlot](Images/RL6280-Predicted2.svg)
+
+
+
+One of the most common ways to represent RNA secondary structure is to simply draw it directly.  The resulting image is easily interpretable, with nucleotides that are base paired being close to each other in space.  
+
+One drawback of this type of image is that effort must be taken to prevent nucleotides from overlapping with eachother, which can make the resulting image confusing.  Another drawback is that this type of representation cannot visualize the ensemble of RNA structures.  However, this type of drawing can be annotated to show predicted base pair probabilities.
+
+### Dot Bracket Notation
+
+```
+GGUUGUUUGGCCGAGCGGUCUAAGGCGCCUGAUUCAAGCUCAGGUAUCGUAAGAUGCAAGAGUUCGAAUCUCUUAGCAACCACCA
+(((((((.(((...((........))))).(((((.(((((..(((((....)))))..))))).)))))....)))))))....
+```
+
+Another common way to convey RNA secondary structure is to use dot-bracket notation.  In the above example, the first line encodes the nucleotide sequence.  The second line uses dot-bracket notation to encode the secondary structure.  In dot-bracket notation, a dot is used to represent an unpaired nucleotide.  An opening bracket (`(`,`{`,`[`,`<`) is used to represent a nucleotide that base pairs with another nucleotide in the 3' direction.  A closeing bracket (`)`, `}`, `]`, `>`) is used to represent a nucleotide that base pairs with a nucleotide in the 5' direction.  
+
+This way of conveying an RNA secondary structure is efficient, but is hard to interpret directly.
+
+### Circle Plots
+
+![CirclePlot](Images/RL6280-Predicted.svg)[]
+
+<img src="Images/RL6280-Predicted.svg"  width="100" height="100">
+
+
+
+### Dot Plots
+
+## RNA Secondary Structure Determination
+
+### Covariance Analysis
+
+
+
+### Chemical Mapping Data
+